The world's first wiki where authorship really matters (Nature Genetics, 2008). Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts. Search thousands of articles and collaborate with scientists around the globe.
wikigene or wiki gene protein drug chemical gene disease author authorship tracking collaborative publishing evolutionary knowledge reputation system wiki2.0 global collaboration genes proteins drugs chemicals diseases compound
Hoffmann, R. A wiki for the life sciences where authorship matters. Nature Genetics (2008)
 
MeSH Review

Cytogenetics

 
 
Welcome! If you are familiar with the subject of this article, you can contribute to this open access knowledge base by deleting incorrect information, restructuring or completely rewriting any text. Read more.
 

Disease relevance of Cytogenetics

  • CONCLUSIONS: The combination of interferon and cytarabine, as compared with interferon alone, increases the rate of major cytogenetic response and prolongs survival in patients with the chronic phase of chronic myelogenous leukemia [1].
  • This finding confirms that the fragile X phenotype can exist, without amplification of the CCG repeat or cytogenetic expression of the fragile X, and that fragile X syndrome is a genetically homogeneous disorder involving FMR1 [2].
  • Here we describe the extrachromosomal (episomal) amplification of ABL1 in 5 of 90 (5.6%) individuals with T-ALL, an aberration that is not detectable by conventional cytogenetics [3].
  • Here we provide evidence that telomere attrition in ageing telomerase-deficient p53 mutant mice promotes the development of epithelial cancers by a process of fusion-bridge breakage that leads to the formation of complex non-reciprocal translocations--a classical cytogenetic feature of human carcinomas [4].
  • A cytogenetic deletion in chromosome 3 (p14-p23) was reported in small-cell lung cancer (SCLC) by Whang-Peng et al [5].
 

Psychiatry related information on Cytogenetics

 

High impact information on Cytogenetics

  • The BCR-ABL story represents a notable example of how research from the fields of cytogenetics, retroviral oncology, protein phosphorylation, and small molecule chemical inhibitors can lead to the development of a successful molecular targeted therapy [10].
  • Here, we show that the longevity QTL in the 36E;38B cytogenetic interval on chromosome 2 contains multiple closely linked QTLs, including the Dopa decarboxylase (Ddc) locus [11].
  • Notably, H2AX maps to a cytogenetic region frequently altered in human cancers, possibly implicating similar functions in man [12].
  • Furthermore, cytogenetic analysis of mouse embryonic fibroblasts reveals that lack of PARP is associated with severe chromosomal instability, characterized by increased frequencies of chromosome fusions and aneuploidy [13].
  • To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression) [14].
 

Chemical compound and disease context of Cytogenetics

 

Biological context of Cytogenetics

 

Anatomical context of Cytogenetics

 

Associations of Cytogenetics with chemical compounds

  • Major cytogenetic responses were observed 12 months after randomization in 126 of 311 patients treated with interferon and cytarabine (41 percent) and in 75 of 314 patients treated with interferon only (24 percent, P<0.001) [1].
  • Furthermore, transmitting males could be differentiated from normal males by their significantly higher expression rates when hybrids were exposed to caffeine before cytogenetic harvest [30].
  • The results, which were repeatable and statistically highly significant, indicated that the weak carcinogen, saccharin, is also mutagenic in the sense that it induces cytogenetic changes [31].
  • Cytogenetic damage induced by folate deficiency in mice is enhanced by caffeine [32].
  • Genetic, cytogenetic, and molecular analyses of mutations induced by melphalan demonstrate high frequencies of heritable deletions and other rearrangements from exposure of postspermatogonial stages of the mouse [33].
 

Gene context of Cytogenetics

  • While dPKC98F transcripts are expressed throughout development, expression of the two genes mapping at cytogenetic location 53E is primarily in adults. dPKC98F and the previously reported 53E gene are transcribed predominantly in brain tissue [34].
  • Position effects with cytogenetic rearrangements well outside the coding region have been implicated for four of the genes discussed: POU3F4, SOX9, PAX6, and GL13 [35].
  • METHODS: We performed a cytogenetic analysis and screened for mutations of the KIT and PDGFRA kinase domains in 26 resistant GISTs [36].
  • A series of molecular cytogenetic studies comparing properties of XIST RNA to other protein coding RNAs, support a critical distinction for XIST RNA; XIST does not concentrate at Xi simply because it is transcribed and processed there [37].
  • Additionally, these cases highlight the need for the careful examination of the FMR1 gene, even in the absence of cytogenetic expression, particularly when several fragile X-like clinical features are present [38].
 

Analytical, diagnostic and therapeutic context of Cytogenetics

References

  1. Interferon alfa-2b combined with cytarabine versus interferon alone in chronic myelogenous leukemia. French Chronic Myeloid Leukemia Study Group. Guilhot, F., Chastang, C., Michallet, M., Guerci, A., Harousseau, J.L., Maloisel, F., Bouabdallah, R., Guyotat, D., Cheron, N., Nicolini, F., Abgrall, J.F., Tanzer, J. N. Engl. J. Med. (1997) [Pubmed]
  2. Fragile X syndrome without CCG amplification has an FMR1 deletion. Gedeon, A.K., Baker, E., Robinson, H., Partington, M.W., Gross, B., Manca, A., Korn, B., Poustka, A., Yu, S., Sutherland, G.R. Nat. Genet. (1992) [Pubmed]
  3. Fusion of NUP214 to ABL1 on amplified episomes in T-cell acute lymphoblastic leukemia. Graux, C., Cools, J., Melotte, C., Quentmeier, H., Ferrando, A., Levine, R., Vermeesch, J.R., Stul, M., Dutta, B., Boeckx, N., Bosly, A., Heimann, P., Uyttebroeck, A., Mentens, N., Somers, R., MacLeod, R.A., Drexler, H.G., Look, A.T., Gilliland, D.G., Michaux, L., Vandenberghe, P., Wlodarska, I., Marynen, P., Hagemeijer, A. Nat. Genet. (2004) [Pubmed]
  4. Telomere dysfunction promotes non-reciprocal translocations and epithelial cancers in mice. Artandi, S.E., Chang, S., Lee, S.L., Alson, S., Gottlieb, G.J., Chin, L., DePinho, R.A. Nature (2000) [Pubmed]
  5. Loss of heterozygosity of chromosome 3p markers in small-cell lung cancer. Naylor, S.L., Johnson, B.E., Minna, J.D., Sakaguchi, A.Y. Nature (1987) [Pubmed]
  6. HRAS1-selected chromosome transfer generates markers that colocalize aniridia- and genitourinary dysplasia-associated translocation breakpoints and the Wilms tumor gene within band 11p13. Porteous, D.J., Bickmore, W., Christie, S., Boyd, P.A., Cranston, G., Fletcher, J.M., Gosden, J.R., Rout, D., Seawright, A., Simola, K.O. Proc. Natl. Acad. Sci. U.S.A. (1987) [Pubmed]
  7. Segregation of FRAXE in a large family: clinical, psychometric, cytogenetic, and molecular data. Hamel, B.C., Smits, A.P., de Graaff, E., Smeets, D.F., Schoute, F., Eussen, B.H., Knight, S.J., Davies, K.E., Assman-Hulsmans, C.F., Oostra, B.A. Am. J. Hum. Genet. (1994) [Pubmed]
  8. Possible genetic damage in the Czech nuclear power plant workers. Sram, R.J., Rössner, P., Rubes, J., Beskid, O., Dusek, Z., Chvatalova, I., Schmuczerova, J., Milcova, A., Solansky, I., Bavorova, H., Ocadlikova, D., Kopecna, O., Musilova, P. Mutat. Res. (2006) [Pubmed]
  9. Rett-like syndrome in fragile X syndrome. Alembik, Y., Dott, B., Stoll, C. Genetic counseling (Geneva, Switzerland) (1995) [Pubmed]
  10. The BCR-ABL story: bench to bedside and back. Wong, S., Witte, O.N. Annu. Rev. Immunol. (2004) [Pubmed]
  11. Dopa decarboxylase (Ddc) affects variation in Drosophila longevity. De Luca, M., Roshina, N.V., Geiger-Thornsberry, G.L., Lyman, R.F., Pasyukova, E.G., Mackay, T.F. Nat. Genet. (2003) [Pubmed]
  12. Histone H2AX: a dosage-dependent suppressor of oncogenic translocations and tumors. Bassing, C.H., Suh, H., Ferguson, D.O., Chua, K.F., Manis, J., Eckersdorff, M., Gleason, M., Bronson, R., Lee, C., Alt, F.W. Cell (2003) [Pubmed]
  13. Functions of poly(ADP-ribose) polymerase in controlling telomere length and chromosomal stability. d'Adda di Fagagna, F., Hande, M.P., Tong, W.M., Lansdorp, P.M., Wang, Z.Q., Jackson, S.P. Nat. Genet. (1999) [Pubmed]
  14. Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat. Yu, S., Mangelsdorf, M., Hewett, D., Hobson, L., Baker, E., Eyre, H.J., Lapsys, N., Le Paslier, D., Doggett, N.A., Sutherland, G.R., Richards, R.I. Cell (1997) [Pubmed]
  15. A point mutation in the FMR-1 gene associated with fragile X mental retardation. De Boulle, K., Verkerk, A.J., Reyniers, E., Vits, L., Hendrickx, J., Van Roy, B., Van den Bos, F., de Graaff, E., Oostra, B.A., Willems, P.J. Nat. Genet. (1993) [Pubmed]
  16. Molecular monitoring in chronic myeloid leukemia patients who achieve complete cytogenetic remission on imatinib. Lin, F., Drummond, M., O'Brien, S., Cervantes, F., Goldman, J., Kaeda, J. Blood (2003) [Pubmed]
  17. Hematopathologic and cytogenetic findings in imatinib mesylate-treated chronic myelogenous leukemia patients: 14 months' experience. Braziel, R.M., Launder, T.M., Druker, B.J., Olson, S.B., Magenis, R.E., Mauro, M.J., Sawyers, C.L., Paquette, R.L., O'Dwyer, M.E. Blood (2002) [Pubmed]
  18. Comparative biochemical and cytogenetic studies of childhood acute lymphoblastic leukemia with the Philadelphia chromosome and other 22q 11 variants. Dow, L.W., Tachibana, N., Raimondi, S.C., Lauer, S.J., Witte, O.N., Clark, S.S. Blood (1989) [Pubmed]
  19. A novel diagnostic screen for defects in the Fanconi anemia pathway. Shimamura, A., de Oca, R.M., Svenson, J.L., Haining, N., Moreau, L.A., Nathan, D.G., D'Andrea, A.D. Blood (2002) [Pubmed]
  20. Anaplastic Wilms' tumour, a subtype displaying poor prognosis, harbours p53 gene mutations. Bardeesy, N., Falkoff, D., Petruzzi, M.J., Nowak, N., Zabel, B., Adam, M., Aguiar, M.C., Grundy, P., Shows, T., Pelletier, J. Nat. Genet. (1994) [Pubmed]
  21. Isolation of a GCC repeat showing expansion in FRAXF, a fragile site distal to FRAXA and FRAXE. Parrish, J.E., Oostra, B.A., Verkerk, A.J., Richards, C.S., Reynolds, J., Spikes, A.S., Shaffer, L.G., Nelson, D.L. Nat. Genet. (1994) [Pubmed]
  22. Physical map and organization of Arabidopsis thaliana chromosome 4. Schmidt, R., West, J., Love, K., Lenehan, Z., Lister, C., Thompson, H., Bouchez, D., Dean, C. Science (1995) [Pubmed]
  23. Sister chromatid exchange frequency in asbestos workers. Rom, W.N., Livingston, G.K., Casey, K.R., Wood, S.D., Egger, M.J., Chiu, G.L., Jerominski, L. J. Natl. Cancer Inst. (1983) [Pubmed]
  24. Cytogenetic and molecular genetic studies of follicular and papillary thyroid cancers. Herrmann, M.A., Hay, I.D., Bartelt, D.H., Ritland, S.R., Dahl, R.J., Grant, C.S., Jenkins, R.B. J. Clin. Invest. (1991) [Pubmed]
  25. Use of heparin in the collection of bone-marrow aspirates for cytogenetic studies. Hagemeijer, A. N. Engl. J. Med. (1981) [Pubmed]
  26. Hematologic neoplasia associated with primary mediastinal germ-cell tumors. Nichols, C.R., Roth, B.J., Heerema, N., Griep, J., Tricot, G. N. Engl. J. Med. (1990) [Pubmed]
  27. An in vitro model for cytogenetic conversion in CML. Interferon-alpha preferentially inhibits the outgrowth of malignant stem cells preserved in long-term culture. Cornelissen, J.J., Ploemacher, R.E., Wognum, B.W., Borsboom, A., Kluin-Nelemans, H.C., Hagemeijer, A., Löwenberg, B. J. Clin. Invest. (1998) [Pubmed]
  28. Olfactory neuroblastoma is a peripheral primitive neuroectodermal tumor related to Ewing sarcoma. Sorensen, P.H., Wu, J.K., Berean, K.W., Lim, J.F., Donn, W., Frierson, H.F., Reynolds, C.P., López-Terrada, D., Triche, T.J. Proc. Natl. Acad. Sci. U.S.A. (1996) [Pubmed]
  29. 53BP1 and p53 synergize to suppress genomic instability and lymphomagenesis. Morales, J.C., Franco, S., Murphy, M.M., Bassing, C.H., Mills, K.D., Adams, M.M., Walsh, N.C., Manis, J.P., Rassidakis, G.Z., Alt, F.W., Carpenter, P.B. Proc. Natl. Acad. Sci. U.S.A. (2006) [Pubmed]
  30. Implications of fragile X expression in normal males for the nature of the mutation. Ledbetter, D.H., Ledbetter, S.A., Nussbaum, R.L. Nature (1986) [Pubmed]
  31. Saccharin-induced sister chromatid exchanges in Chinese hamster and human cells. Wolff, S., Rodin, B. Science (1978) [Pubmed]
  32. Cytogenetic damage induced by folate deficiency in mice is enhanced by caffeine. MacGregor, J.T., Schlegel, R., Wehr, C.M., Alperin, P., Ames, B.N. Proc. Natl. Acad. Sci. U.S.A. (1990) [Pubmed]
  33. Genetic, cytogenetic, and molecular analyses of mutations induced by melphalan demonstrate high frequencies of heritable deletions and other rearrangements from exposure of postspermatogonial stages of the mouse. Russell, L.B., Hunsicker, P.R., Cacheiro, N.L., Rinchik, E.M. Proc. Natl. Acad. Sci. U.S.A. (1992) [Pubmed]
  34. Isolation and characterization of two new drosophila protein kinase C genes, including one specifically expressed in photoreceptor cells. Schaeffer, E., Smith, D., Mardon, G., Quinn, W., Zuker, C. Cell (1989) [Pubmed]
  35. Transcription factors in disease. Engelkamp, D., van Heyningen, V. Curr. Opin. Genet. Dev. (1996) [Pubmed]
  36. Mechanisms of resistance to imatinib mesylate in gastrointestinal stromal tumors and activity of the PKC412 inhibitor against imatinib-resistant mutants. Debiec-Rychter, M., Cools, J., Dumez, H., Sciot, R., Stul, M., Mentens, N., Vranckx, H., Wasag, B., Prenen, H., Roesel, J., Hagemeijer, A., Van Oosterom, A., Marynen, P. Gastroenterology (2005) [Pubmed]
  37. XIST RNA paints the inactive X chromosome at interphase: evidence for a novel RNA involved in nuclear/chromosome structure. Clemson, C.M., McNeil, J.A., Willard, H.F., Lawrence, J.B. J. Cell Biol. (1996) [Pubmed]
  38. Two new cases of FMR1 deletion associated with mental impairment. Hirst, M., Grewal, P., Flannery, A., Slatter, R., Maher, E., Barton, D., Fryns, J.P., Davies, K. Am. J. Hum. Genet. (1995) [Pubmed]
  39. Persistence of dormant leukemic progenitors during interferon-induced remission in chronic myelogenous leukemia. Analysis by polymerase chain reaction of individual colonies. Talpaz, M., Estrov, Z., Kantarjian, H., Ku, S., Foteh, A., Kurzrock, R. J. Clin. Invest. (1994) [Pubmed]
  40. Xenograft model of progressive human proliferative breast disease. Miller, F.R., Soule, H.D., Tait, L., Pauley, R.J., Wolman, S.R., Dawson, P.J., Heppner, G.H. J. Natl. Cancer Inst. (1993) [Pubmed]
  41. Role of fibroblast growth factor receptor signaling in prostate cancer cell survival. Ozen, M., Giri, D., Ropiquet, F., Mansukhani, A., Ittmann, M. J. Natl. Cancer Inst. (2001) [Pubmed]
  42. Succinyl CoA: 3-oxoacid CoA transferase (SCOT): human cDNA cloning, human chromosomal mapping to 5p13, and mutation detection in a SCOT-deficient patient. Kassovska-Bratinova, S., Fukao, T., Song, X.Q., Duncan, A.M., Chen, H.S., Robert, M.F., Pérez-Cerdá, C., Ugarte, M., Chartrand, C., Vobecky, S., Kondo, N., Mitchell, G.A. Am. J. Hum. Genet. (1996) [Pubmed]
  43. Reverse transcription polymerase chain reaction for the rearranged retinoic acid receptor alpha clarifies diagnosis and detects minimal residual disease in acute promyelocytic leukemia. Miller, W.H., Kakizuka, A., Frankel, S.R., Warrell, R.P., DeBlasio, A., Levine, K., Evans, R.M., Dmitrovsky, E. Proc. Natl. Acad. Sci. U.S.A. (1992) [Pubmed]
 
WikiGenes - Universities