The world's first wiki where authorship really matters (Nature Genetics, 2008). Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts. Search thousands of articles and collaborate with scientists around the globe.
wikigene or wiki gene protein drug chemical gene disease author authorship tracking evolutionary knowledge reputation system wiki2.0 global collaboration genes proteins drugs chemicals diseases compound
Hoffmann, R. A wiki for the life sciences where authorship matters. Nature Genetics (2008)
 
 
 
 

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase ( TP).[1]

References

  1. Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE. Blazquez, A., Martín, M.A., Lara, M.C., Martí, R., Campos, Y., Cabello, A., Garesse, R., Bautista, J., Andreu, A.L., Arenas, J. Neuromuscul. Disord. (2005)
 
 
 
 
 
 
 
[search][advanced]

Editor

Links