The world's first wiki where authorship really matters (Nature Genetics, 2008). Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts. Search thousands of articles and collaborate with scientists around the globe.

wikigene or wiki gene protein drug chemical gene disease author authorship tracking collaborative publishing evolutionary knowledge reputation system wiki2.0 global collaboration genes proteins drugs chemicals diseases compound
Hoffmann, R. A wiki for the life sciences where authorship matters. Nature Genetics (2008)
 

Editor

Share

Personal info

View

Links

About

Terms

 

 
 

Cooperative interactions in the tandem of oligonucleotide derivatives arranged at complementary target. Quantitative estimates and contribution of the target secondary structure.

The intraduplex reaction of the alkylating reagent CIRCH2NHpd(TTCCCA) (X, ClR is p-(N-2-chloroethyl-N-methylaminophenyl) residue) with the target 26-mer d(TTGCCTTGAATGGGAAGAGGGTCATT) (P) in the presence of effectors was studied. The effectors used were Phn-L-pd(TTCAAGGC)p-L-Phn (E1) and Phn-L-pd(TGACCCTC)p-L-Phy (E2), where Phn is N-(2-hydroxyethyl)-phenazinium residue and L is NHCH2CH2NH spacer. The dependence of the alkylation extent of the target on the reagent concentration was treated using the equation derived earlier for the two-component system (reagent + target) to calculate association constants of X with P, PE1, PE2 and PE1E2. The latter were found to be Kxe1 = 6.75 x 10(5) M-1, Kxe2 = 4.15 x 10(4) M-1 and Kxe12 = 5.87 x 10(6) M-1 as compared with the affinity of X to P Kx = 2.16 x 10(4) M-1 in the absence of effectors. Taking into account the internal structure of the target, co-operativity parameters describing interactions in the tandem E1 x X x E2 arranged at the target were calculated as alpha 1 = 16, alpha 2 = 10 and alpha 12 = 139 for the duplexes PXE1, PXE2 and PXE1E2.[1]

References

  1. Cooperative interactions in the tandem of oligonucleotide derivatives arranged at complementary target. Quantitative estimates and contribution of the target secondary structure. Fedorova, O.S., Adeenah-Zadah, A., Knorre, D.G. FEBS Lett. (1995) [Pubmed]
Annotations and hyperlinks in this abstract are from individual authors of WikiGenes or automatically generated by the WikiGenes Data Mining Engine. The abstract is from MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.About WikiGenesOpen Access LicencePrivacy PolicyTerms of Useapsburg
 
WikiGenes - Universities