The world's first wiki where authorship really matters (Nature Genetics, 2008). Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts. Search thousands of articles and collaborate with scientists around the globe.

wikigene or wiki gene protein drug chemical gene disease author authorship tracking collaborative publishing evolutionary knowledge reputation system wiki2.0 global collaboration genes proteins drugs chemicals diseases compound
Hoffmann, R. A wiki for the life sciences where authorship matters. Nature Genetics (2008)
 
 
 

Identification of Vibrio proteolyticus with a differential medium and a specific probe.

A differential medium (VP8) and a specific probe, based on the variable region V3 of the 16S rRNA gene, for the detection of Vibrio proteolyticus are defined. The medium contains 8% NaCl, which allows selective growth of moderately halophilic Vibrio strains. D-Sorbitol, as the main carbon source, differentiates the species that can ferment it by the pH indicators cresol red and bromothymol blue. V. proteolyticus and 8 of 418 strains studied grew on the medium and used the D-sorbitol, forming bright yellow colonies. An oligonucleotide, based on the variable region V3 of the 16S rRNA gene (5'CGCTAACGTCAAATAATGCATCTA3'), was used as the specific probe (V3VPR). Only three strains of Vibrio sp. and one strain identified as V. natriegens cross-hybridized with the probe. However, unlike V. proteolyticus, none of the strains grew on VP8. The combined use of VP8 medium and the probe allowed an unequivocal identification of V. proteolyticus.[1]

References

  1. Identification of Vibrio proteolyticus with a differential medium and a specific probe. Muniesa-Pérez, M., Jofre, J., Blanch, A.R. Appl. Environ. Microbiol. (1996) [Pubmed]
 
WikiGenes - Universities