The world's first wiki where authorship really matters (Nature Genetics, 2008). Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts. Search thousands of articles and collaborate with scientists around the globe.

wikigene or wiki gene protein drug chemical gene disease author authorship tracking collaborative publishing evolutionary knowledge reputation system wiki2.0 global collaboration genes proteins drugs chemicals diseases compound
Hoffmann, R. A wiki for the life sciences where authorship matters. Nature Genetics (2008)
 

Editor

Share

Personal info

View

Links

About

Terms

 

 
 

Growth inhibition and antimetastatic effect of antisense poly-DNP-RNA on human breast cancer cells.

The RNase-resistant and membrane-permeable antisense poly-2'-O-(2,4-dinitrophenyl)-oligoribonucleotides (poly-DNP-RNA) against RIalpha subunit of protein kinase A (RIalpha/PKA) has been used to inhibit the growth of human breast cancer MDA-MB-231 cells in vitro and in vivo. This antisense poly-DNP-RNA, with oligonucleotide sequence GGGCGUGCCUCCUCACUGGC, was found to be an effective concentration-dependent inhibitor of MDA-MB-231 cell line, whereas the control poly-DNP-RNAs with either random or sense sequence were found completely inactive. In situ hybridization studies showed that this antisense inhibitor can permeate spontaneously into MDA-MB-231 cells and distribute itself throughout the cytoplasm. Intraperitoneal administration of this antisense RIalpha poly-DNP-RNA to SCID mice with transplanted MDA-MB-231 cells was found to inhibit the growth of the xenografts in a concentration-dependent way, prevent metastasis, and drastically reduce mortality.[1]

References

  1. Growth inhibition and antimetastatic effect of antisense poly-DNP-RNA on human breast cancer cells. Ru, K., Schmitt, S., James, W.I., Wang, J.H. Oncol. Res. (1999) [Pubmed]
Annotations and hyperlinks in this abstract are from individual authors of WikiGenes or automatically generated by the WikiGenes Data Mining Engine. The abstract is from MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.About WikiGenesOpen Access LicencePrivacy PolicyTerms of Useapsburg
 
WikiGenes - Universities