Hoechst 33342-induced apoptosis is associated with intracellular accumulation of E2F-1 protein in BC3H-1 myocytes and HL-60 cells.
CONTEXT: Hoechst 33342 induces apoptosis, inhibits topoisomerase I, and disrupts TATA box-binding protein/TATA box element binding in BC3H-1 myocytes and HL-60 cells. In contrast, Hoechst 33258 does not have any of these actions. OBJECTIVE: To determine if Hoechst 33342 or Hoechst 33258 treatment of BC3H-1 myocytes or HL-60 cells is associated with the intracellular accumulation of the nuclear transcription factor E2F-1, known to induce apoptosis. METHODS: The gel mobility shift assay was used to study the effect of the 2 compounds on the binding capacity of nuclear proteins extracted from the 2 cell lines to a 30-base pair double-stranded oligonucleotide that contained an E2F-1-binding element. The DNA sequence of the protein-binding region was determined by the protection footprinting method and the Maxam-Gilbert guanosine plus adenosine chemical sequencing reaction. RESULTS: Nuclear extracts from each cell line treated with 26.7 micromol/L Hoechst 33342 or Hoechst 33258 for 3 to 24 hours were incubated with [32P]-labeled 30-base pair oligonucleotide (5'GGCGCGGAGACTTGGAGAAATTTGGCGCGG3'). Three protein and DNA bands were altered by Hoechst 33342, but not by Hoechst 33258: band I, increased, then decreased in both cell lines; band II (2 adjacent bands) markedly decreased in both cell lines; band III markedly increased only in HL-60 cells. Footprinting and sequencing demonstrated that the nuclear protein-binding sequence was TTTGGCGC, an E2F-1 binding site. Hoechst 33342 treatment increased the concentration of E2F-1 protein after a 3-hour incubation in both cell lines. CONCLUSION: Hoechst 33342-induced apoptosis is associated with intracellular accumulation of E2F-1 protein, another step in this specific apoptotic pathway.[1]References
- Hoechst 33342-induced apoptosis is associated with intracellular accumulation of E2F-1 protein in BC3H-1 myocytes and HL-60 cells. Zhang, X., Kiechle, F.L. Arch. Pathol. Lab. Med. (2001) [Pubmed]
Annotations and hyperlinks in this abstract are from individual authors of WikiGenes or automatically generated by the WikiGenes Data Mining Engine. The abstract is from MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.About WikiGenesOpen Access LicencePrivacy PolicyTerms of Useapsburg
