Disease relevance of FRA16B

• Although FRA16B was detected only in PBLs from two healthy subjects who had been previously treated for non-Hodgkin's lymphoma (NHL), both cell types displayed FRA16B in a patient with chronic myelomonocytic leukemia (CMMoL) [1].
• Dominant inheritance of cleft palate, microstomia and micrognathia--possible linkage to the fragile site at 16q22 (FRA16B) [2].

Psychiatry related information on FRA16B

• These interindividually variable, extremely large repeat expansions of 15-70 kb in size do not seem to interfere with the expression of genes essential for human development since heterozygotes and homozygotes for FRA16B are normal [3].

High impact information on FRA16B

• Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat [4].
• To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression) [4].
• This specific leukemic breakpoint is within the metallothionein gene cluster, which is here shown to be proximal to the rare fragile site (FRA16B) and to a common fragile site (FRA16C) in this region [5].
• Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich approximately 33 bp repeat; however, the relationship between normal and fragile site alleles is not known [6].
• Mutational analysis in this region specifically excludes expansion of the AT-rich minisatellite repeat FRA16B fragile site and the CAG trinucleotide repeat in the E2F-4 transcription factor [7].

Biological context of FRA16B

• These sequences show similarity to the AT-rich minisatellite repeats that underlie the fragility of the rare fragile sites FRA16B and FRA10B [8].
• Homozygotes for FRA16B are normal [9].
• The FRA16B locus was late replicating and appeared to replicate even later on fragile chromosomes [10].
• The existence of normal homozygotes for FRA16B suggests that this fragile site is not within a gene essential for normal development [9].
• "Spontaneous" FRA16B is a hot spot for sister chromatid exchanges [11].

Anatomical context of FRA16B

• Mapping of 33 anonymous DNA probes and 12 genes to the long arm of chromosome 16 was achieved by the use of 14 mouse/human hybrid cell lines and the fragile site FRA16B [12].
• No chromosomal gaps, breaks, or reaRrangements at 16q22 were noted in lymphocytes treated from these cases, indicating that AMMoL patients with inv(16)(p13q22) do not always have the rare fragile site FRA16B, FRA(16)(q22) [13].
• Differential expression of FRA16B in peripheral lymphocytes and bone marrow cells [1].
• Here we investigated the AT islands in the FRA16B fragile site region for their possible roles in the organization of DNA on the nuclear matrix [14].

Associations of FRA16B with chemical compounds

• We document two unrelated normal individuals who are homozygotes for the rare fragile site FRA16B and record the patterns of induction of this fragile site with berenil [9].
• Human fragile site FRA16B DNA excludes nucleosomes in the presence of distamycin [15].

Other interactions of FRA16B

• There were no recombinants (theta = 0.0, z = 8.3) between D16S10 and D16S4, which flank FRA16B [16].
• AT islands in fragile sites FRA16B and FRA16D are significantly more abundant in CEM cells that are hypersensitive to bizelesin compared to normal WI-38 cells [14].

References