Disease relevance of Stallimycin

• Compounds 3a, 3b, and 3c have been synthesized, and the interaction of distamycin A, 2, 3a, 3b, and 3c with calf thymus DNA, poly(dA-dT), poly(dG-dC), poly(dI-dC), pBR322 superhelical plasmid DNA, and, in the case of 3b, T4 coliphage DNA have been studied [1].
• Distamycin A, which is a minor groove binder that mimics the architectural structure generated by G1P at pac, enhances the specific cut at both bona fide 5'-CTATTGCGG downward arrowC-3' sequences within pacC of SPP1 and SF6 phages [2].
• Reduction of nitric oxide synthase 2 expression by distamycin A improves survival from endotoxemia [3].
• Pausing of HIV RT at the polyadenosine tract could be enhanced by either distamycin A or netropsin, (A-T)-rich minor groove binding peptides [4].
• Antiviral activity of distamycin A against vaccinia virus is the result of inhibition of postreplicative mRNA synthesis [5].

High impact information on Stallimycin

• To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression) [6].
• Two techniques were especially useful in the mapping: "cloning" 14S + 25S DNA on the plasmid pMB9 to amplify individual R1 fragments, and digesting DNA with R1 in the presence of the antibiotic distamycin A to produce specific partial digestion products [7].
• Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded approximately 42 bp repeats [8].
• The mobility shift assay was used to study the competition of the minor groove binder distamycin A with either an Antennapedia homeodomain (Antp HD) peptide or derivatives of a fushi tarazu homeodomain (ftz HD) peptide for their AT-rich DNA binding site [9].
• Distamycin A is a well known polyamide antibiotic that can bind in the minor groove of duplex DNA primarily at AT-rich sequences both as a monomer or as a side-by-side antiparallel dimer [10].

Chemical compound and disease context of Stallimycin

• In this study, we first investigated the efficacy and toxic effects of tallimustine, a distamycin-A derivative, in a human leukemia model in severe combined immunodeficient (SCID) mice [11].
• Our aim was to establish, in patients with solid tumors, the dose-limiting toxicity, maximum tolerated dose (MTD), and pharmacology of PNU-145156E, a new sulfonated distamycin A derivative that blocked circulating angiogenesis-promoting growth factors in animal studies and exhibited an antitumor effect in murine solid tumors [12].
• The antiproliferative activity of the hybrids has been tested in vitro on human myeloid leukemia K562 and T-lymphoid Jurkat cell lines and compared to antiproliferative effects of the natural product distamycin A 1, its tetrapyrrole homologue 17, DC 81 (4), and the PBD methyl ester 12 [13].
• The use of antibiotics actinomycin D and distamycin A for mapping of phage lambda HindIII fragments [14].
• Inhibitor studies of phage T4 wild-type and mutant DNA polymerases. III. Distamycin A, actinomycin D, adriamycin, daunomycin and ethidium [15].

Biological context of Stallimycin

• Netropsin and distamycin A gave identical DNA cleavage-inhibition patterns and bound preferentially to A+T-rich regions with a minimal protected site of four base pairs [16].
• Distamycin A modulates the sequence specificity of DNA alkylation by duocarmycin A [17].
• Unexpectedly, it is shifted by 1 bp with respect to the distamycin A binding site on this DNA sequence [18].
• The results are discussed in connection with the inhibitory effect of a related ligand, distamycin A, on DNA methylation [19].
• Effect of distamycin A on Chinese hamster chromosomes [20].

Anatomical context of Stallimycin

• The broadest spectrum of activity and greatest potency was shown by the hybrid 24, in which the alkylating unit 20 and the deformyl distamycin A are tethered by 1-methyl 2,5-dicarbonyl pyrazole, with IC(50) values for the different tumor cell lines ranging from 7 to 71 nM [21].
• The rare fragile site at 17p12 can be induced in lymphocyte cultures with the AT-specific DNA-ligands distamycin A, DAPI, Hoescht 33258 and berenil [22].
• In cultured amniotic fluid cells a mediocentric chromosome 9 appeared to be completely deficient in constitutive heterochromatin when stained with distamycin A and DAPI [23].
• The condensation of the brightly fluorescing Y-heterochromatin is prevented by cultivating leukocytes in a medium containing distamycin A [24].
• Anti-insulin-like growth factor-I activity of a novel polysulphonated distamycin A derivative in human lung cancer cell lines [25].

Associations of Stallimycin with other chemical compounds

• We have compared the effect of distamycin A and actinomycin D on a number of restriction endonucleases having different nucleotide sequences in the recognition sites and established that antibiotic action depends on the nucleotide sequences of the recognition sites and their closest environment[26]
• Netropsin, distamycin A, and berenil inhibit DNA topoisomerase-mediated relaxation of supercoiled DNA by an as-yet unknown mechanism [27].
• Since distamycin A and MATH20 are able to displace histone H1 and other DNA-binding proteins bound to specific AT-rich sequences by a dominant, mutually exclusive fashion, these results suggest that 5-bromodeoxyuridine targets such an AT-rich sequence located adjacent to the silenced transgene, resulting in chromatin accessibility [28].
• In fact, upon substitution of thymine with 5-bromouracil, a rat S/MAR sequence reduced its degree of bending and became insensitive to cancellation of the bending by distamycin A [29].
• Tallimustine or N-deformyl-N-[4-N-N,N-bis(2-chloroethylamino)benzoyl], a distamycin-A derivative (FCE 24517), is a novel anti-cancer agent which alkylates N3 adenine in the minor groove of DNA [30].

Gene context of Stallimycin

• Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich approximately 33 bp repeat; however, the relationship between normal and fragile site alleles is not known [8].
• However, HMGA1 could not bind alone either to consensus or to modified EREs, and the minor groove binding drug distamycin A failed to prevent the synergism between ER and HMGA1 [31].
• Instead, we found that the GST-Cdc6 can compete with distamycin A for binding to the DNA molecule [32].
• Our results demonstrate that reversible MGBs (DAPI, distamycin A, Hoechst 33258, and netropsin) are effective inhibitors of the formation of DNA/TBP complex and that distamycin A is the most potent (0.16 microM inhibits TBP complex formation by 50%) [33].
• New sulfonated distamycin A derivatives with bFGF complexing activity [34].

Analytical, diagnostic and therapeutic context of Stallimycin

• Using a combination of MPE.Fe(II) cleavage of drug-protected DNA fragments and Maxam-Gilbert gel methods of sequence analysis, we have determined the preferred binding sites on a Rsa I-EcoRI restriction fragment from pBR322 for the intercalator actinomycin D and the minor groove binders netropsin and distamycin A [16].
• The binding between Distamycin 3 and the palindromic duplexes d(CGTTTAAACG)2 and d(CGTACGTACG)2 was investigated by two independent techniques: UV-Vis absorption in the Job's plot approach and Induced Circular Dichroism [35].
• N-deformyl-N-[4-N,N-bis(2-chloroethylamino)benzoyl] distamycin-A (FCE 24517) is a new cytotoxic anti-tumor agent in phase-1 clinical trials [36].
• HPLC product analysis showed that duocarmycin A reacted with a double-helical DNA octamer d(CCCCGGGG)2 in the presence of distamycin A to produce duocarmycin A-guanine adduct, while duocarmycin A alone did not react with the octamer [37].
• Longitudinal differentiation of metaphase chromosomes of Indian muntjac as studied by restriction enzyme digestion, in situ hybridization with cloned DNA probes and distamycin A plus DAPI fluorescence staining [38].

References