High impact information on OXTR

• Molecular cloning of a human MafF homologue, which specifically binds to the oxytocin receptor gene in term myometrium [1].
• The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term [1].
• The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition [1].
• To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium [1].
• The expression of the OTR within the mammalian uterus is regulated during gestation with a peak at the day of delivery [2].

Biological context of OXTR

• The oxytocin (OT) -oxytocin receptor (OTR) system plays a key role in many aspects of mammalian reproduction as well as several other physiological processes such as bond pairing and cardiovascular homeostasis [2].

Anatomical context of OXTR

• This review summarizes the current knowledge of the complex regulation of OTR transcription in the myometrium and the intracellular signaling mechanisms through which OT mediates its potent stimulatory effects [2].
• The activated OTR increases contraction frequency and increases force by sensitizing the contractile apparatus of the myocytes to calcium [2].

Analytical, diagnostic and therapeutic context of OXTR

• Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif [1].

References