The world's first wiki where authorship really matters (Nature Genetics, 2008). Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts. Search thousands of articles and collaborate with scientists around the globe.

wikigene or wiki gene protein drug chemical gene disease author authorship tracking collaborative publishing evolutionary knowledge reputation system wiki2.0 global collaboration genes proteins drugs chemicals diseases compound
Hoffmann, R. A wiki for the life sciences where authorship matters. Nature Genetics (2008)
 
Gene Review: 

EhV2gp51  -  ORF 50

Equid herpesvirus 2

 
 
Welcome! If you are familiar with the subject of this article, you can contribute to this open access knowledge base by deleting incorrect information, restructuring or completely rewriting any text. Read more.
 

Disease relevance of EhV2gp51

 

High impact information on EhV2gp51

 

Biological context of EhV2gp51

  • (ii) Only the primate Rta/Orf50 homologs were able to interfere with human p53-depedent transcriptional activation [9].
  • This report begins to analyze the process by which butyrate activates the promoter of KSHV open reading frame 50 (ORF50), the key viral regulator of the KSHV latency to lytic cycle switch [10].
  • Two KSHV lytic-cycle promoters are activated by a similar mechanism that involves direct recognition of a homologous response element by the DNA binding domain of ORF 50 protein in the context of related cellular proteins [11].
  • The identification of an autoregulatory region emphasizes that the many functions of ORF50 protein must be subject to exquisite control to achieve optimal KSHV lytic-cycle gene expression [12].
  • In HH-B2, a newly established primary effusion lymphoma (PEL) cell line, KSHV ORF50 behaved as an immediate-early gene and autostimulated its own expression [13].
 

Anatomical context of EhV2gp51

  • In insect and mammalian cell lines, Sp1 significantly activated the ORF50 promoter linked to luciferase [10].
  • The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cells and B cells in the absence of other KSHV proteins [11].
  • Here we show that deregulated expression of a single viral gene, ORF 50, which encodes a transactivator able to selectively upregulate delayed-early viral genes, suffices to disrupt latency and induce the lytic gene cascade in latently infected B cells [14].
  • A newly identified palindrome (PAL2), containing a 12-bp response region required for ORF50-induced activation in lymphoid cells, was identified in the K8 promoter [15].
 

Associations of EhV2gp51 with chemical compounds

  • These findings support the role of LANA as a transcriptional repressor of lytic reactivation and provide evidence that lysine acetylation regulates LANA interactions with chromatin, Sp1, and ORF50 promoter DNA [7].
  • Using the pull-down assay with extracts of KSHV-infected cells, ORF50 protein was shown to interact with a glutathione S-transferase-ORF57 fusion protein [16].
  • The ORF50/K8 transcript was resistant to cyclohexamide, whereas the K8 transcript was only partially resistant to cyclohexamide at early timepoints [17].
 

Regulatory relationships of EhV2gp51

  • The expression from some (e.g., nut-1) but not all (e.g., tk) ORF 50-responsive promoters can be synergistically enhanced by coexpression of ORF 50 and ORF 57 [18].
 

Other interactions of EhV2gp51

  • Here we identify and characterize a DNA binding site for the ORF50 protein that is shared by the promoters of two delayed early genes (ORF57 and K-bZIP) [19].
 

Analytical, diagnostic and therapeutic context of EhV2gp51

References

  1. Activation of latent Kaposi's sarcoma-associated herpesvirus by demethylation of the promoter of the lytic transactivator. Chen, J., Ueda, K., Sakakibara, S., Okuno, T., Parravicini, C., Corbellino, M., Yamanishi, K. Proc. Natl. Acad. Sci. U.S.A. (2001) [Pubmed]
  2. Identification of the immediate-early transcripts of Kaposi's sarcoma-associated herpesvirus. Zhu, F.X., Cusano, T., Yuan, Y. J. Virol. (1999) [Pubmed]
  3. The ORF45 protein of Kaposi's sarcoma-associated herpesvirus is associated with purified virions. Zhu, F.X., Yuan, Y. J. Virol. (2003) [Pubmed]
  4. The latency-associated nuclear antigen of rhesus monkey rhadinovirus inhibits viral replication through repression of Orf50/Rta transcriptional activation. DeWire, S.M., Damania, B. J. Virol. (2005) [Pubmed]
  5. CREB-binding protein and histone deacetylase regulate the transcriptional activity of Kaposi's sarcoma-associated herpesvirus open reading frame 50. Gwack, Y., Byun, H., Hwang, S., Lim, C., Choe, J. J. Virol. (2001) [Pubmed]
  6. Identification and characterization of the Orf49 protein of Kaposi's sarcoma-associated herpesvirus. González, C.M., Wong, E.L., Bowser, B.S., Hong, G.K., Kenney, S., Damania, B. J. Virol. (2006) [Pubmed]
  7. Acetylation of the latency-associated nuclear antigen regulates repression of Kaposi's sarcoma-associated herpesvirus lytic transcription. Lu, F., Day, L., Gao, S.J., Lieberman, P.M. J. Virol. (2006) [Pubmed]
  8. Cyclooxygenase 2 induced by Kaposi's sarcoma-associated herpesvirus early during in vitro infection of target cells plays a role in the maintenance of latent viral gene expression. Sharma-Walia, N., Raghu, H., Sadagopan, S., Sivakumar, R., Veettil, M.V., Naranatt, P.P., Smith, M.M., Chandran, B. J. Virol. (2006) [Pubmed]
  9. Comparison of the Rta/Orf50 transactivator proteins of gamma-2-herpesviruses. Damania, B., Jeong, J.H., Bowser, B.S., DeWire, S.M., Staudt, M.R., Dittmer, D.P. J. Virol. (2004) [Pubmed]
  10. An Sp1 response element in the Kaposi's sarcoma-associated herpesvirus open reading frame 50 promoter mediates lytic cycle induction by butyrate. Ye, J., Shedd, D., Miller, G. J. Virol. (2005) [Pubmed]
  11. Open reading frame 50 protein of Kaposi's sarcoma-associated herpesvirus directly activates the viral PAN and K12 genes by binding to related response elements. Chang, P.J., Shedd, D., Gradoville, L., Cho, M.S., Chen, L.W., Chang, J., Miller, G. J. Virol. (2002) [Pubmed]
  12. Autoregulation of DNA binding and protein stability of Kaposi's sarcoma-associated herpesvirus ORF50 protein. Chang, P.J., Miller, G. J. Virol. (2004) [Pubmed]
  13. Kaposi's sarcoma-associated herpesvirus open reading frame 50/Rta protein activates the entire viral lytic cycle in the HH-B2 primary effusion lymphoma cell line. Gradoville, L., Gerlach, J., Grogan, E., Shedd, D., Nikiforow, S., Metroka, C., Miller, G. J. Virol. (2000) [Pubmed]
  14. Reactivation of Kaposi's sarcoma-associated herpesvirus infection from latency by expression of the ORF 50 transactivator, a homolog of the EBV R protein. Lukac, D.M., Renne, R., Kirshner, J.R., Ganem, D. Virology (1998) [Pubmed]
  15. Lytic switch protein (ORF50) response element in the Kaposi's sarcoma-associated herpesvirus K8 promoter is located within but does not require a palindromic structure. Seaman, W.T., Quinlivan, E.B. Virology (2003) [Pubmed]
  16. Functional co-operation between the Kaposi's sarcoma-associated herpesvirus ORF57 and ORF50 regulatory proteins. Malik, P., Blackbourn, D.J., Cheng, M.F., Hayward, G.S., Clements, J.B. J. Gen. Virol. (2004) [Pubmed]
  17. Gene expression from the ORF50/K8 region of Kaposi's sarcoma-associated herpesvirus. Seaman, W.T., Ye, D., Wang, R.X., Hale, E.E., Weisse, M., Quinlivan, E.B. Virology (1999) [Pubmed]
  18. Kaposi's sarcoma-associated herpesvirus open reading frame 57 encodes a posttranscriptional regulator with multiple distinct activities. Kirshner, J.R., Lukac, D.M., Chang, J., Ganem, D. J. Virol. (2000) [Pubmed]
  19. DNA binding by Kaposi's sarcoma-associated herpesvirus lytic switch protein is necessary for transcriptional activation of two viral delayed early promoters. Lukac, D.M., Garibyan, L., Kirshner, J.R., Palmeri, D., Ganem, D. J. Virol. (2001) [Pubmed]
 
WikiGenes - Universities