Disease relevance of EhV2gp51

• KSHV Lyta (lytic transactivator, also named KSHV/Rta), mainly encoded by the ORF 50 gene, is a lytic switch gene for viral reactivation from latency, inasmuch as it is both essential and sufficient to drive the entire viral lytic cycle [1].
• 2. ORF50 is a homologue of Rta, a transcription activator encoded by Epstein-Barr virus (EBV) [2].
• In contrast, ORF50/Rta, K8alpha, and ORF59/PF8 were not detected in the same virion preparation [3].
• The latency-associated nuclear antigen of rhesus monkey rhadinovirus inhibits viral replication through repression of Orf50/Rta transcriptional activation [4].
• Kaposi's sarcoma (KS)-associated herpesvirus (KSHV) open reading frame 50 (ORF50) encodes a viral transcriptional activator, which binds to the KSHV promoter and stimulates the transcription of viral early and late genes, thus activating the lytic cycle of KSHV [5].

High impact information on EhV2gp51

• We have characterized an unknown open reading frame, Orf49, which lies adjacent and in the opposite orientation to Orf50 [6].
• Reactivation of the Kaposi's sarcoma-associated herpesvirus (KSHV) lytic cycle can be initiated by transcription activation of the ORF50 immediate early gene (Rta) [7].
• In contrast, lytic ORF50 gene expression and ORF50 promoter activity were unaffected [8].
• Depletion of LANA by small interfering RNA derepressed ORF50 transcription in the latently infected BCBL1 pleural effusion lymphoma-derived cell line [7].
• Histone deacetylase inhibitors, including sodium butyrate (NaB) and trichostatin A, caused the rapid dissociation of LANA from the ORF50 promoter [7].

Biological context of EhV2gp51

• (ii) Only the primate Rta/Orf50 homologs were able to interfere with human p53-depedent transcriptional activation [9].
• This report begins to analyze the process by which butyrate activates the promoter of KSHV open reading frame 50 (ORF50), the key viral regulator of the KSHV latency to lytic cycle switch [10].
• Two KSHV lytic-cycle promoters are activated by a similar mechanism that involves direct recognition of a homologous response element by the DNA binding domain of ORF 50 protein in the context of related cellular proteins [11].
• The identification of an autoregulatory region emphasizes that the many functions of ORF50 protein must be subject to exquisite control to achieve optimal KSHV lytic-cycle gene expression [12].
• In HH-B2, a newly established primary effusion lymphoma (PEL) cell line, KSHV ORF50 behaved as an immediate-early gene and autostimulated its own expression [13].

Anatomical context of EhV2gp51

• In insect and mammalian cell lines, Sp1 significantly activated the ORF50 promoter linked to luciferase [10].
• The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cells and B cells in the absence of other KSHV proteins [11].
• Here we show that deregulated expression of a single viral gene, ORF 50, which encodes a transactivator able to selectively upregulate delayed-early viral genes, suffices to disrupt latency and induce the lytic gene cascade in latently infected B cells [14].
• A newly identified palindrome (PAL2), containing a 12-bp response region required for ORF50-induced activation in lymphoid cells, was identified in the K8 promoter [15].

Associations of EhV2gp51 with chemical compounds

• These findings support the role of LANA as a transcriptional repressor of lytic reactivation and provide evidence that lysine acetylation regulates LANA interactions with chromatin, Sp1, and ORF50 promoter DNA [7].
• Using the pull-down assay with extracts of KSHV-infected cells, ORF50 protein was shown to interact with a glutathione S-transferase-ORF57 fusion protein [16].
• The ORF50/K8 transcript was resistant to cyclohexamide, whereas the K8 transcript was only partially resistant to cyclohexamide at early timepoints [17].

Regulatory relationships of EhV2gp51

• The expression from some (e.g., nut-1) but not all (e.g., tk) ORF 50-responsive promoters can be synergistically enhanced by coexpression of ORF 50 and ORF 57 [18].

Other interactions of EhV2gp51

• Here we identify and characterize a DNA binding site for the ORF50 protein that is shared by the promoters of two delayed early genes (ORF57 and K-bZIP) [19].

Analytical, diagnostic and therapeutic context of EhV2gp51

• Chromatin immunoprecipitation assays indicated that LANA interacts with the ORF50 promoter region in latently infected cells [7].
• By means of electrophoretic mobility shift assays, both Sp1 and Sp3 were shown to form complexes in vitro with the ORF50 promoter at the Sp1 site [10].
• Deletion of aa 521 to 534 or mutation of a basic motif (KKRK) in this regulatory region dramatically enhances DNA binding by ORF50 protein, as shown by electrophoretic mobility shift, DNA affinity chromatography, and chromatin immunoprecipitation assays [12].
• Using 3' rapid amplification of cDNA ends, RT-PCR, and cDNA library screening, we demonstrate that the major ORF50 transcript also encodes K8 [17].
• Co-immunoprecipitations with extracts of KSHV-infected cells showed that ORF57 and ORF50 proteins were present in the same complex [16].

References