Disease relevance of PGR

• Expression of active hormone and DNA-binding domains of the chicken progesterone receptor in E. coli [1].
• Internuclear migration of chicken progesterone receptor, but not simian virus-40 large tumor antigen, in transient heterokaryons [2].

High impact information on PGR

• The purine contact sites for both form A and form B chicken progesterone receptor, as well as those for rat glucocorticoid receptor, are identical [3].
• Chicken oviduct progesterone receptor: location of specific regions of high-affinity binding in cloned DNA fragments of hormone-responsive genes [4].
• We have used a DNA-cellulose competitive binding assay to measure the extent of displacement of the chicken oviduct progesterone-receptor complex from calf thymus DNA-cellulose by purified cloned fragments of genomic DNA [4].
• The results suggest that specific double-stranded DNA sequences are recognized by the oviduct progesterone-receptor complex in vitro, and are relevant to the question of whether specific DNA sequences are directly involved as genomic binding sites for steroid receptors [4].
• Based on a comparison of such sequences of homology, a consensus sequence that may constitute a region binding progesterone-receptor complex has been constructed: ATCCCTTATTATTCTGGTTTGTA [4].

Biological context of PGR

• The results showed that this mutation resulted in reduced transcriptional activity of chicken progesterone receptor at low hormone concentrations but did not affect the maximal activity of the receptor at saturating levels of hormone, suggesting that the phosphorylation at Ser530 influences the response of the receptor to its ligand [5].
• Phosphorylation of Ser530 facilitates hormone-dependent transcriptional activation of the chicken progesterone receptor [5].
• Progestin administration seemed to decrease PR immunoreactivity especially in the heterochromatin area, suggesting that conformational chromatin rearrangements occur during down-regulation of PR [6].
• PR isoforms protein content increased during embryonic development in both female and male chick brain [7].
• A 36-amino acid peptide sequence obtained by microsequencing of purified progesterone receptor was encoded by nucleotide sequences in the longest cDNA clone [8].

Anatomical context of PGR

• The general validity of the subunit model of the progesterone receptor from chick oviduct appears questionable. Comparison of progesterone and estrogen receptor [9].
• Progesterone receptor was found in the nuclei of glandular and luminal epithelia, stroma, smooth muscle cells and in the mesothelium [6].
• A progestin-inducible protein, avidin, was found in part of the luminal and glandular epithelium cells but not in other PR-positive cell types [6].
• The biological significance of the in vitro observations is demonstrated by GA's ability to (i) rapidly block PR's hormone binding capacity in intact cells and (ii) alter the composition of COS cell PR complexes in a manner similar to that observed during in vitro reconstitutions [10].
• In this study a model system for expression of the chicken progesterone receptor in cultured cells was developed using a quail fibroblast cell line, QT6 [11].

Associations of PGR with chemical compounds

• In this study, one of the hormone-induced phosphorylation sites of chicken progesterone receptor, Ser530, was mutated to alanine, a nonphosphorylatable amino acid, and the transcriptional activity of the mutant receptor was compared with that of wild type in a transient cotransfection assay [5].
• Estrogen and progesterone administration had effects also on ER and PR immunoreactivity [6].
• Progesterone and estradiol participate in the regulation of several reproductive functions through interaction with intracellular progesterone receptors (PR) and estrogen receptors (ER), respectively [7].
• Analysis of the amino acid sequence of the progesterone receptor deduced from the cDNA clones revealed a cysteine-rich region that was homologous to a region found in the estrogen and glucocorticoid receptors and to the avian erythroblastosis virus gag-erb-A fusion protein [8].
• Progesterone receptor structure and function altered by geldanamycin, an hsp90-binding agent [10].

Physical interactions of PGR

• Addition to lysate of monoclonal antibody against hsp70 inhibits hsp90 binding to PR and destabilizes preformed complexes [12].
• The purified DNA binding component (receptor A) of the chick oviduct progesterone receptor has been analyzed for its ability to bind to the cloned ovalbumin gene and to plasmid DNA of various structural compositions [13].
• Interaction of eukaryotic class-B transcription factors and chick progesterone-receptor complex with conalbumin promoter sequences [14].

Enzymatic interactions of PGR

• Purified preparations of epidermal growth factor (EGF) receptor were used to test hen oviduct progesterone receptor subunits as substrates for phosphorylation catalyzed by EGF receptor [15].
• Both the 80-kilodalton (kDa) (A) and the 105-kDa (B) progesterone receptor subunits were phosphorylated in a reaction that required EGF and EGF receptor [15].

Regulatory relationships of PGR

• Here, we show that a high concentration of the potent glucocorticoid and progesterone receptor antagonist RU486 almost completely blocks phenobarbital-induced accumulation of CYP2H1 mRNA in hepatocytes yet has no effect on basal expression [16].
• Estrogen regulation of the biological activity of the avian oviduct progesterone receptor and its ability to induce avidin [17].

Other interactions of PGR

• Whereas numerous attempts to reversibly bind components to the activated receptor have been unsuccessful, we now report conditions that promote the reassociation of hsp90 and hsp70 to progesterone receptor [18].
• Quantitative RT-PCR showed that gonadal ERalpha transcript levels in juvenile alligators decreased after E2 treatment whereas ERbeta and PR transcripts were not changed [19].
• The level of PR mRNA was increased only by estrogen, while no steroid hormone affected the levels of ER and GR mRNAs [20].
• No phosphorylation of progesterone receptor subunits was observed in the absence of EGF receptor, even when Ca2+ was substituted for Mg2+ and Mn2+ [15].
• Various procedures were used to solubilize nuclear progesterone receptor (0.5 M KCl, micrococcal nuclease, NaDodSO4), and in no case was 32P-labeled B subunit detected in the extracts [21].

Analytical, diagnostic and therapeutic context of PGR

• At the subcellular level, PR was localized in the chromatin by immunoelectron microscopy [6].
• In this work, we determined PR and ER-alpha isoforms content in the brain of chicks of both sexes on days 8 and 13 of embryonic development as well as on the day of hatching by Western blot analysis [7].
• Molecular cloning of the chicken progesterone receptor [8].
• Northern blot analysis with chicken progesterone receptor cDNA's indicated the existence of at least three messenger RNA species [8].
• We have taken advantage of the high yield provided by an affinity chromatography method for partial purification and after the incorporation of additional steps, we obtained purified progesterone receptor devoid of detectable contaminants and suitable for chemical analysis [22].

References