Disease relevance of Olig1

• Furthermore, multilamellar wrapping of myelin membranes around axons does not occur, despite recognition and contact of axons by oligodendrocytes, and Olig1-null mice develop widespread progressive axonal degeneration and gliosis [1].
• The effects of inhibitors, antisense oligo-nucleotides, and siRNA for Cl- transporters on bone resorption activities were evaluated using a pit formation assay [2].
• In vivo, G3139 treatment (25 mg/kg every 3 days x 5 doses) delayed engraftment and significantly inhibited growth of established C666-1 xenografts in SCID mice compared to control oligo-treated animals [3].
• Immunochemical properties of monoclonal autoantibodies to single stranded DNA (ssDNA), which were derived from systemic lupus erythematosus (SLE) prone mice and were specific for poly(dG), were studied using a hapten inhibition assay with oligo- and mononucleotides [4].
• Demonstration of the expression of UL53 mRNA in brains of mice infected with HSV-1 strains was made possible by the combined use of a rapid method for mRNA extraction (Oligo dT-linked magnetic beads) and a highly sensitive technique for detection of the existence of the UL53-specific mRNA (cDNA synthesis followed by PCR) [5].

High impact information on Olig1

• Ectopic expression of Olig1 promotes oligodendrocyte formation and reduces neuronal survival in developing mouse cortex [6].
• Studies have indicated that oligodendrocytes in the spinal cord originate from a ventral progenitor domain defined by expression of the oligodendrocyte-determining bHLH proteins Olig1 and Olig2 [7].
• In this study, we provide the in vivo evidence for a late phase of Olig gene expression independent of Nkx6 and Shh gene activities and reveal a brief second wave of oligodendrogenesis in the dorsal spinal cord [8].
• As expected, oligo-nucleotide-directed RNase H cleavage of this portion of murine U7 inhibits the in vitro processing reaction [9].
• We have used oligo-nucleotides complementary to partial amino acid sequence of LIF to isolate a LIF clone from a T lymphocyte cDNA library [10].

Biological context of Olig1

• Whereas addition of Shh, FGF-2, and PDGF could induce OPC differentiation in 12% of the NSCs, the transient expression of Olig1 by use of Nucleofector gene transfection initiated OPC differentiation in 55% of the NSCs [11].
• Finally, differentiation of mOP cells was accompanied by up-regulation of mRNA encoding Olig2 but not Olig1, which is consistent with previous findings showing that Olig2 is necessary for specification of oligodendrocytes [12].
• We observed prominent down-regulation of most transcription factors present in telencephalic precursors upon growth factor exposure in neurosphere cultures while Olig1 and Olig2 expression was strongly up-regulated [13].
• In this study, we identified Zfp488, an oligodendrocyte-specific zinc-finger transcription regulator, by screening for genes downregulated in the optic nerves of Olig1-null mice [14].
• Analysis of mice lacking Olig function demonstrates a failure of NG2 cell development at embryonic and perinatal stages that can be rescued by addition of a transgene containing the human OLIG2 locus [15].

Anatomical context of Olig1

• Based on these findings, we propose that oligodendrocytes derive from several distinct positional origins and that the activation of Olig1/2 at different positions is controlled by distinct genetic programs [7].
• Transient expression of Olig1 initiates the differentiation of neural stem cells into oligodendrocyte progenitor cells [11].
• RESULTS: We report that Olig genes, encoding basic helix-loop-helix (bHLH) proteins, are expressed in a subset of Nkx2.2 progenitors before the establishment of interneurons and oligodendroglial precursors [16].
• These findings strongly suggest that IFN-gamma is required in the early phases of induction of the oligo- and polyclonal proliferative and cytotoxic responses of lymphocytes [17].
• To investigate the age-dependent molecular changes in a mouse model, we compared the expression profiles of metaphase II oocytes collected from 5- to 6-week-old mice with those collected from 42- to 45-week-old mice using the NIA 22K 60-mer oligo microarray [18].

Associations of Olig1 with chemical compounds

• Recent studies in gnotobiotic mouse models of ChAG have shown that parietal cell loss results in amplification of multi- and oligo-potential gastric stem cells that express sialylated glycan receptors recognized by H. pylori adhesins [19].
• Increased specificity of reverse transcription priming by trehalose and oligo-blockers allows high-efficiency window separation of mRNA display [20].
• These species sedimenting at 16S and 19S in aqueous sucrose density gradients were also quantitatively retained by oligo (dT)-cellulose [21].
• The presence of guanine (Gua)-containing mono-, oligo-, and polynucleotides also abolished and/or decreased 3H-labeled antibody binding to ssDNA-agarose [22].
• Competition-inhibition studies with soluble mono-, oligo-, and polynucleotides revealed that GMP- and TMP-reactive antibodies were highly specific for oligo(dG)n and -(dT)n sequences, respectively [23].

Physical interactions of Olig1

• When the 8 bp spacer was removed, however, the oligo T3WSF (same as the T3W with spacer free) but not T3SF (T3 without spacer) binds to p53, indicating that both the spacer between two motifs and consensus binding sites determined the p53 binding [24].
• We identified a 21-bp sequence CTGTTTATGATGGCGAGGGGG in Oligo IV that specifically binds the RANKL-induced nuclear protein from RAW264.7 cells by performing a series of competition assays [25].
• We have directed a polyclonal antibody against an oligo-peptide (123-136) of the transcription factor cyclic AMP responsive element-binding protein (CREB) including the serine residue at 133 [26].
• Oligo-1 inhibited acetyl-LDL binding to the scavenger receptor on mouse splenocytes [27].

Regulatory relationships of Olig1

• In both areas, mRNA up-regulation of the transcriptional target gene Patched was observed in cells expressing the oligodendroglial transcription factor Olig1 [28].
• Gain-of-function analysis in transgenic mouse embryos indicates that Olig genes specifically inhibit the establishment of Sim1-expressing V3 interneurons [16].
• Compared on a weight basis to oligo(RGD) or RGD peptide, poly(RGD) was more active than the oligo- and monomeric peptide at inhibiting tumor cell adhesion to immobilized fibronectin [29].

Other interactions of Olig1

• In particular, interactions between Olig and Nkx2.2 proteins inhibit V3 interneuron development and promote the formation of alternate cell types, including those expressing Sox10 [16].
• Olig3 was isolated as a third member of Olig family, but its precise expression pattern is poorly understood [30].
• Finally, FACS-purified LC (Ia+ EC) clearly expressed IL-1 beta and MIP-1 alpha mRNA, a finding that was verified by Southern blotting using internal oligo probes [31].
• P-glycoprotein-mediated multidrug resistance phenotype of L1210/VCR cells is associated with decreases of oligo- and/or polysaccharide contents [32].
• We have analyzed sequence from 63 oligo-capped, cloned cDNA fragments and identify six transcription start points associated with the Mobp gene at postnatal day 26 [33].

Analytical, diagnostic and therapeutic context of Olig1

• One of the peptides that was not homologous to any known protein was used to instruct the designing of an oligonucleotide sense primer that was used in combination with an oligo dT nucleotide (anti-sense primer) to amplify by PCR a DNA fragment from L. donovani cDNA [34].
• In addition, the long-term effect of bile acid-induced oxidative DNA damage on cholangiocytes was investigated using a mouse oligo DNA microarray [35].
• Western blots of tumor extracts obtained during oligo treatment showed that Bcl-2 levels were significantly decreased in G3139-treated animals [3].
• In mice tested with i.t. administration of CGS-12066A, none of the oligo treatments produced a significant attenuation of analgesia [36].
• In the present study, we performed pairwise oligo microarray analysis to characterize gene expression profiles in PECAM1-positive and -negative subpopulations of ES cells [37].

References